About: isa:295298005   Sponge Permalink

An Entity of Type : prov:Entity, within Data Space : webisadb.webdatacommons.org associated with source dataset(s)

AttributesValues
rdf:type
prov:value
  • ROMOTER CLONINGProx_FW ??? ggacccttcttctcctcttaProx_RV ??? caggcgctattgtacttcDist_FW ??? atggctaccttgtcagcacttccDist_RV ??? gcctcttcccttttgtactttccOligonucleotide sequences for Chip, 3C as well as plasmids and other material are available upon request.Figure 5linc-MD1 Acts as a Natural Decoy for miR-135 and miR-133The linc-MD1 cDNA (RLuc-MD1-WT) and mutant derivatives lacking the putative miR-133
prov:wasQuotedFrom
is prov:wasDerivedFrom of
Alternative Linked Data Views: ODE     Raw Data in: CXML | CSV | RDF ( N-Triples N3/Turtle JSON XML ) | OData ( Atom JSON ) | Microdata ( JSON HTML) | JSON-LD    About   
This material is Open Knowledge   W3C Semantic Web Technology [RDF Data] Valid XHTML + RDFa
OpenLink Virtuoso version 07.20.3217, on Linux (x86_64-pc-linux-gnu), Standard Edition
Data on this page belongs to its respective rights holders.
Virtuoso Faceted Browser Copyright © 2009-2012 OpenLink Software